Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circ7374/TNS4 | |||
Gene | TNS4 | Organism | Human |
Genome Locus | chr17:38638380-38638668:n/a | Build | hg19 |
Disease | Colorectal Cancer | ICD-10 | Malignant neoplasm of rectosigmoid junction (C19) |
DBLink | Link to database | PMID | 25624062 |
Experimental Method | |||
Sample Type | Tissue and CRC Cell lines | Comparison | Tumour tissues and matched normal colon mucosa from 31 Colorectal Cancer patients |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CAGACGACTCGATGAGGAAGTG ReverseCAAACTCACCATCCCACAGAGA | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Bachmayr-Heyda, A, Reiner, AT, Auer, K, Sukhbaatar, N, Aust, S, Bachleitner-Hofmann, T, Mesteri, I, Grunt, TW, Zeillinger, R, Pils, D (2015). Correlation of circular RNA abundance with proliferation--exemplified with colorectal and ovarian cancer, idiopathic lung fibrosis, and normal human tissues. Sci Rep, 5:8057. |